View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20024_low_21 (Length: 252)
Name: NF20024_low_21
Description: NF20024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20024_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 24621467 - 24621692
Alignment:
| Q |
17 |
aattatgtctaccttaacaatcatacaaacggtgaattatgatttatcgacagcgtaaaaatgtttggacgataatgtatcaaaattagtctaaaaaagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24621467 |
aattatgtctaccttaacaatcatacaaacggtgaattatgatttatcgacagcgtaaaaatgtttggacgataatgtatcaaaattagtctaaaaaagt |
24621566 |
T |
 |
| Q |
117 |
aagagcattaacttccgtctctttcaaaggaacatttgtttaagaaaacaccatgtgttgactaatgtaatggacatggtagctttactaaattaaccct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24621567 |
aagagcattaacttccgtctctttcaaaggaacatttgtttaagaaaacaccatgtgttgactaatgtaatggacatggtagctttactaaactaaccct |
24621666 |
T |
 |
| Q |
217 |
a-ttttttaacagaaagtaaccctat |
241 |
Q |
| |
|
| |||||||||| || ||||| |||| |
|
|
| T |
24621667 |
acttttttaacataaggtaactctat |
24621692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 219
Target Start/End: Original strand, 47674232 - 47674267
Alignment:
| Q |
184 |
taatggacatggtagctttactaaattaaccctatt |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47674232 |
taatggacatggtagttttactaaattaaccctatt |
47674267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University