View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20024_low_22 (Length: 244)
Name: NF20024_low_22
Description: NF20024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20024_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 1718450 - 1718568
Alignment:
| Q |
1 |
cacaaattcttattgattattctaaaaagaaaatcttattttatattattctaaacacaatggtaacaagcaaaactgcacacatctccgatgataaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718450 |
cacaaattcttattgattattctaaaaagaaaatcttattttatattattctaaacacaatggtaacaagcaaaactgcacacatctccgatgataaaaa |
1718549 |
T |
|
| Q |
101 |
taattagttaacatatata |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1718550 |
taattagttaacatatata |
1718568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 229
Target Start/End: Original strand, 1718627 - 1718679
Alignment:
| Q |
177 |
acaagcaacaccacattaattattgaaatattgagtggggtttattctaaatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718627 |
acaagcaacaccacattaattattgaaatattgagtggggtttattctaaatt |
1718679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University