View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20025_high_22 (Length: 243)
Name: NF20025_high_22
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20025_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 29280158 - 29279932
Alignment:
| Q |
1 |
gtttgcagcgtaaccacaatttaaaatcatgatttaaactgtgttccaaataattatatgattaaaattttatcattgagctgacacctcgtgaacgatg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||| ||| ||| |
|
|
| T |
29280158 |
gtttgcagcctaaccacaatttaaaatcatgatttaaactttgttccaaataattataagattaaaattttatcactgagctgacacctcgtaaacaatg |
29280059 |
T |
|
| Q |
101 |
taatgtagactctattataactcaattgaatgagaaataatttcaaaaagaattcaaaaagcaaaatggctatagaaagtgatgttacctgttttgcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280058 |
taatgtagactctattataactcaattgaatgagaaataatttcaaaaagaattcaaaaagaaaaatggctatagaaagtgatgttacctgttttgcttc |
29279959 |
T |
|
| Q |
201 |
ctcgcccattttggtgtatgaagtatc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29279958 |
ctcgcccattttggtgtatgaagtatc |
29279932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 42945084 - 42945056
Alignment:
| Q |
1 |
gtttgcagcgtaaccacaatttaaaatca |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42945084 |
gtttgcagcgtaaccacaatttaaaatca |
42945056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University