View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20025_low_10 (Length: 349)
Name: NF20025_low_10
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20025_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 339
Target Start/End: Complemental strand, 10011681 - 10011371
Alignment:
| Q |
19 |
aaaacatgcagttgatctatttcccacgcatgttcacacactaaaccagcatctatcataacnnnnnnnattctagctcttcttcccatgctaactttag |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10011681 |
aaaacatgcagctgatctatttcccacgcatgttcacacactaaaccagcatctatcataactttttttattctagctcttcttcccatgctaactttag |
10011582 |
T |
|
| Q |
119 |
gaatcacagtgctctcttcccttggttcaacaacacagtatctatccaactcttcaatgccatctgcatagctgcatgttctccgccagaatctttcatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10011581 |
gaatcacagtgctctcttcccttggttcaacagcacagtatccatccaactcttcaatgccatctccatagctgcatgttctccgccagaatctttcat- |
10011483 |
T |
|
| Q |
219 |
aaccttcatcaacaacgaaatttacgacatgttttggatcgattcaatgatcaccgaggatttcttattttttctgcaaaagatgaacacccctcattgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10011482 |
---------caacaacgaaatttacgacatgttttggatcgattcaatgatcaccgaggatttcttattttttctgcaaaagatgaacacccctctttgt |
10011392 |
T |
|
| Q |
319 |
tgtccaaatccaagctctgtg |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10011391 |
tgtccaaatccaagctctgtg |
10011371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University