View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20025_low_16 (Length: 286)
Name: NF20025_low_16
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20025_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 21283461 - 21283728
Alignment:
| Q |
1 |
tgccgcattttaggagggttggatgaacaatcaccttaatttaatggttaatattccattgagatcaagttaaagaaggatggaccaaaacacaatgtgg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21283461 |
tgccgcattttagaagggttggatgaacaatcaccttaatttaatggttaatattccattgagatcaagttaaagaaggatggaccaaaacacaatgtgg |
21283560 |
T |
 |
| Q |
101 |
cctaagccttttaaaatgaagtctaaacgcagtattaataatgtgaaactttgtnnnnnnnnnnnnntgcatggagcttattgtatggannnnnnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21283561 |
cctaagccttttaaaatgaagtctaaacgcagtattaataatgtgaaactttgtaaaaaagaaaaaatgcatggagcttattgtatggatattttttttt |
21283660 |
T |
 |
| Q |
201 |
nnnnnngaaaaaactattgtatgaattgttgtctttcttttctttttatgtcttcaataaatcaattttt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21283661 |
ttaaa--aaaaaactattgtatgaattgttgtctttcttttctttttatgtcttcaataaatcaattttt |
21283728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University