View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20025_low_17 (Length: 271)
Name: NF20025_low_17
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20025_low_17 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 144 - 271
Target Start/End: Complemental strand, 4716363 - 4716235
Alignment:
| Q |
144 |
aacacctca-attccggcttgttaattacttccaggccgggtttacttatattttatgcccaaagcaatgcctaatcattaattgcagtttaaagataac |
242 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716363 |
aacacctcatattacggcttgttaattacttccaggccgggtttacttaaattttatgctcaaagcaatgcctaatcattaattgcagtttaaagataac |
4716264 |
T |
 |
| Q |
243 |
gtgagagaatagaaaatcagaatcagcat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4716263 |
gtgagagaatagaaaatcagaatcagcat |
4716235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 4716506 - 4716429
Alignment:
| Q |
1 |
ttccctataaattctctctcatattcctaaacaaaaggcctctcatattgtatctgataaaatatattgtccatcttg |
78 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716506 |
ttccctataaattatctctcagattcctaaacaaaaggcctctcatattgtatctgataaaatatattgtccatcttg |
4716429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University