View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20025_low_19 (Length: 258)

Name: NF20025_low_19
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20025_low_19
NF20025_low_19
[»] chr1 (2 HSPs)
chr1 (171-243)||(10722873-10722947)
chr1 (70-102)||(10722775-10722807)


Alignment Details
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 171 - 243
Target Start/End: Original strand, 10722873 - 10722947
Alignment:
171 atatgatcatgatttgcaaccatagatgccaactcaaatgttgtagtgttagacaaaataa--aggggttaaaca 243  Q
    ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||  ||||||||||||    
10722873 atatgatcatgatttgcaaccatggatgccaactcaaatgttgtggtgttagacaaaaaaaataggggttaaaca 10722947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 102
Target Start/End: Original strand, 10722775 - 10722807
Alignment:
70 ttatttctttgtcctttgattactatcatgatg 102  Q
    |||||||||||||||||||||||||||||||||    
10722775 ttatttctttgtcctttgattactatcatgatg 10722807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University