View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20025_low_19 (Length: 258)
Name: NF20025_low_19
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20025_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 171 - 243
Target Start/End: Original strand, 10722873 - 10722947
Alignment:
| Q |
171 |
atatgatcatgatttgcaaccatagatgccaactcaaatgttgtagtgttagacaaaataa--aggggttaaaca |
243 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
10722873 |
atatgatcatgatttgcaaccatggatgccaactcaaatgttgtggtgttagacaaaaaaaataggggttaaaca |
10722947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 102
Target Start/End: Original strand, 10722775 - 10722807
Alignment:
| Q |
70 |
ttatttctttgtcctttgattactatcatgatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10722775 |
ttatttctttgtcctttgattactatcatgatg |
10722807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University