View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20025_low_23 (Length: 249)
Name: NF20025_low_23
Description: NF20025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20025_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 38315000 - 38315216
Alignment:
| Q |
1 |
attcatatatctcataagtcatatactagccatatcaaattgctctaacatttacgagttaatagtaagtttggcataatcacagtgtaccacgttgatt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38315000 |
attcgtatatctcataagtcatatactagccatatcaaattgctctaacatttacgagttaatggtaagtttggcataatctcagtgtaccacgttgatt |
38315099 |
T |
|
| Q |
101 |
ttacgatgtatatcatattgtacactttagaatttcaacaaaatcatgtttccaccgtaatttcagcataaaaaatattgtattaaaatgattttaagtt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38315100 |
ttacggtgtatatcatattgtacactttaaaatttcaacaaaatcatgttttcaccgtaatttcagcataaaaaatattgtattaaaatgattttaagtt |
38315199 |
T |
|
| Q |
201 |
aatgatgcaaatcataa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38315200 |
aatgatgcaaatcataa |
38315216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 199 - 244
Target Start/End: Original strand, 38315231 - 38315276
Alignment:
| Q |
199 |
ttaatgatgcaaatcataacttaaacctatataatattttcttgga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38315231 |
ttaatgatgcaaatcataacttaaacctatgtaatatttttttgga |
38315276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University