View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20026_high_19 (Length: 263)
Name: NF20026_high_19
Description: NF20026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20026_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 65 - 227
Target Start/End: Complemental strand, 54947907 - 54947747
Alignment:
| Q |
65 |
attgaaatgactatttttaaatggcattcaaaatttctgcatgagtccctgcggtgagagagag--ttgcgggtttatctctatgaaaaatgcttggcaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| | | ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54947907 |
attgaaatgactatttttaaatggcattcaaaatttctc----agtccctactgagagagagagaattgcgggtttatctctatgaaaaatgcttggcaa |
54947812 |
T |
 |
| Q |
163 |
acggtcggtcacacaacattgccggggaagtttttttcacaaaactatcaacaacttttaaattg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54947811 |
acggtcggtcacacaacattgccggggaagtttttttcacaaaactatcaacaacttttaaattg |
54947747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 54947935 - 54947906
Alignment:
| Q |
18 |
tttgtaattttataaattcaaatattatat |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54947935 |
tttgtaattttataaattcaaatattatat |
54947906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University