View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20026_high_20 (Length: 212)
Name: NF20026_high_20
Description: NF20026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20026_high_20 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 13088042 - 13087972
Alignment:
| Q |
142 |
ggtatattagattatataatctaatatcatgcagaggatgaagaatggggagcagtgagacgacaacgatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13088042 |
ggtatattagattatataatctaatatcatgcagaggatgaagaatggggagcagtgagacgacaacgatc |
13087972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 10 - 76
Target Start/End: Complemental strand, 13088174 - 13088108
Alignment:
| Q |
10 |
aaaaaagcttaagagattatctctaagtttaatttaatattcgattctccattacaaaacacaattc |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13088174 |
aaaaaagcttaagagattatctctaagtttaatttaatattcgattctccattacaaaacacaattc |
13088108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University