View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20026_low_18 (Length: 283)
Name: NF20026_low_18
Description: NF20026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20026_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 47655221 - 47654973
Alignment:
| Q |
16 |
ataaaatactacaaacactaacatttatcatttcagaaaaaataaccttcgggttctcccgagtttaacatgaaaattttacgccaagaatcctgaagag |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47655221 |
ataaaatactacaaacactaatatttatcatttcagaaaaaataacctttgggttctcccgagttcaacatgaaaattttacgccaagaatcctgaagag |
47655122 |
T |
 |
| Q |
116 |
gtatattctaagatgaaaaacacattccagttgatcatcaatcaagttattgaaataatcactatggctttcaaacacagttgacacaccaaggcaatta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47655121 |
gtatattctaagatgaaaaacacattccagttgatcatcaatcaagttattgaaataatcactatggttttcaaacacagttgacacaccaaggcaatta |
47655022 |
T |
 |
| Q |
216 |
ggattcaggagaacaacaccggggtagaaacccgaaccctattacatcc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47655021 |
ggattcaggagaacaacaccggggtagaaacccgaaccctattacatcc |
47654973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University