View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20027_high_19 (Length: 295)
Name: NF20027_high_19
Description: NF20027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20027_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 7 - 279
Target Start/End: Complemental strand, 12366463 - 12366191
Alignment:
| Q |
7 |
acatcatcaacaactacagccctcgccactggcgtctcatagacttaatctccgccgcgtttttcggcttagtgtttcttttctttgttttcgtattcac |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12366463 |
acatcatcaacaactacaaccctcgccactggcgtctcatagacttaatctccgccgcgtttttcggcttagtgtttcttttctttgttttcgtattcac |
12366364 |
T |
|
| Q |
107 |
ttccttaggtgattcactcgccgcctcagggaggcagacgctgctgatgtcaggctctgatccacagcagcgtctgcgtctggtggcggcgattgaagta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12366363 |
ttccttaggtgattcactcgccgcctcagggaggcagacgctgctgatgtcaggctctgatccacagcagcgtctgcgtctggtggcggcgattgaagta |
12366264 |
T |
|
| Q |
207 |
ggacagagagttattgatgcttgtcctgctgatgctgtggatcatatgccgtgtgagaatccgaggttgaata |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12366263 |
ggacagagagttattgatgcttgtcctgctgatgctgtggatcatatgccgtgtgagaatccgaggttgaata |
12366191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University