View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20027_low_23 (Length: 288)
Name: NF20027_low_23
Description: NF20027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20027_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 272
Target Start/End: Original strand, 41344648 - 41344912
Alignment:
| Q |
8 |
aagcataggaacgatgataagtggagggacaatttgtgcagttaataaattccccttcatcttctccttttccacaaacgaaacaaacaatgtcatgtat |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
41344648 |
aagcacaggaacgatgataagtggagggacaatttgtgcagttaataaattccccttcatcttctccctttccacaaactaaacaaacaatgtcatgtat |
41344747 |
T |
 |
| Q |
108 |
gggagcatacatgaacatgtctcgacgtttttgttcatcctctttcaaccacttactaatcaggatgttttggaggacggacttccgtgtcgccaccaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41344748 |
gggagcatacatgaacatgtctcgacgtttttgttcatcctctttcaaccacttactaatcaggatgttttggaggacggacttccgtgtcgccaccaaa |
41344847 |
T |
 |
| Q |
208 |
atgcgtttgtatggttgtatatcctcactttgagcatgcttctcaaacttccatacagagatttc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41344848 |
atgcgtttgtatggttgtatatcctcactttgagcatgcttctcaaacttccatacagagatttc |
41344912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 101
Target Start/End: Complemental strand, 5743972 - 5743938
Alignment:
| Q |
67 |
tcttctccttttccacaaacgaaacaaacaatgtc |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
5743972 |
tcttctccttttccacaaactaaacaaacaatgtc |
5743938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 101
Target Start/End: Complemental strand, 5780931 - 5780897
Alignment:
| Q |
67 |
tcttctccttttccacaaacgaaacaaacaatgtc |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
5780931 |
tcttctccttttccacaaactaaacaaacaatgtc |
5780897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 101
Target Start/End: Complemental strand, 5751762 - 5751729
Alignment:
| Q |
68 |
cttctccttttccacaaacgaaacaaacaatgtc |
101 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
5751762 |
cttctccttttccacaaactaaacaaacaatgtc |
5751729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 68 - 101
Target Start/End: Complemental strand, 5788721 - 5788688
Alignment:
| Q |
68 |
cttctccttttccacaaacgaaacaaacaatgtc |
101 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
5788721 |
cttctccttttccacaaactaaacaaacaatgtc |
5788688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 9994134 - 9994082
Alignment:
| Q |
212 |
gtttgtatggttgtatatcctcactttgagcatgcttctcaaacttccataca |
264 |
Q |
| |
|
|||| |||||||| ||||||||||||||| | ||| ||||||| ||||||||| |
|
|
| T |
9994134 |
gtttctatggttgcatatcctcactttgaacgtgcatctcaaagttccataca |
9994082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University