View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20027_low_27 (Length: 272)
Name: NF20027_low_27
Description: NF20027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20027_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 80 - 261
Target Start/End: Original strand, 15979702 - 15979881
Alignment:
| Q |
80 |
taaatgaatttatctcatgtaactggtacaatagaaaaatctcaaattcattcattacgtacatgtacaaggaaaacaattatgtttcatatctctacat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
15979702 |
taaatgaatttatctcatgtaactggtacaatagaaaaatctcaaattcatt----acgtacatgtacaaagaaaacaattatgtttcatatctcaacat |
15979797 |
T |
 |
| Q |
180 |
ttgtaaacattatttt--ttcttttcgtgtcaaaaggataattcagcaagtaaataaccactaataaattctttaatacatatt |
261 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15979798 |
ttgtaaacattattttttttcttttcgtgtcaaaaggataattcagcaagtaaataaccactaataaattctttaatacatatt |
15979881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 15979268 - 15979337
Alignment:
| Q |
19 |
accgttgacataataaaaattgtcttggttcattattgtgttaaagtcttttggtcggtagtaaatgaat |
88 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15979268 |
accgttcacataataaaaattgtcttggttcattattgtgttaaagtcttttggtcggtagtaaatgaat |
15979337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University