View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20028_high_20 (Length: 313)
Name: NF20028_high_20
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20028_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 32217301 - 32217032
Alignment:
| Q |
18 |
gaaggccgtgtcatccaacgttatagtccaaccactcaaccattagccattgaagtactttttctttctctctctgaaattgctttgtatacatatttct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32217301 |
gaaggccgtgtcatccaacgttatagtccaaccacccaaccattagccattgaagtactttttctttctctctctgaaattgctttgtatacatatttca |
32217202 |
T |
|
| Q |
118 |
ttatctatgcatatttatatatctttgagaggttaaattaatttgcattttcacatatctttgacagaatgatatcaagaaagcactgagagtggctaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32217201 |
ttatctatgcatatttatatatctttgagaggttaaattattttgcattttcacatatctttgacagaatgatatcaagaaagcactgagagtggctaat |
32217102 |
T |
|
| Q |
218 |
tgagagactctacaactatttcagttcaggccattgctggtgtgctgaagatatatcttataatacctcc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32217101 |
tgagagactctacaactatttcagttcaggccattgctggtgtgctgaagatatatcttataatacctcc |
32217032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University