View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20028_high_26 (Length: 274)
Name: NF20028_high_26
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20028_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 4845027 - 4845288
Alignment:
| Q |
1 |
aaaagaagctttgcagcctccaccagccatggct-tgccgcaagccgcaacttcaaaagcaacaactgccttacctgcccccaagaaaagtgcatcatct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4845027 |
aaaagaagctttgcagcctccaccagccatggctatgccgcaagccgcaacttcaaaagcaacaactgccttacctgcccccaagaaaagtgcatcatat |
4845126 |
T |
 |
| Q |
100 |
caaccgcaacttaaatgtccgatggccggaaccttttatatttcgaatagaacagtgaggtgtcaaaactcaatttgc--aaaaacatacttggctaatt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
4845127 |
caaccgcaacttaaatgtccgatggccggaaccttttatatttcaaatagaacagtgaggtgtcaaaactcaatttgcaaaaaaaaatacttggctaatt |
4845226 |
T |
 |
| Q |
198 |
gattcatccacaaatccctttgtatttgatccttatagtttgtgaatcgaatataatcaaac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4845227 |
gattcatccacaaatccctttgtatttgatccttatagtttgtgaatcgaatataatcaaac |
4845288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 50 - 137
Target Start/End: Original strand, 4865545 - 4865632
Alignment:
| Q |
50 |
cttcaaaagcaacaactgccttacctgcccccaagaaaagtgcatcatctcaaccgcaacttaaatgtccgatggccggaacctttta |
137 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||||||| | ||||||||||||||| || | || |||||||||||||| ||||||||||| |
|
|
| T |
4865545 |
cttcgaaagcaacacctgccttacctccccccaaaacaagtgcatcatctcacccaccgctgaaatgtccgatggcaggaacctttta |
4865632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 173 - 231
Target Start/End: Original strand, 4818834 - 4818893
Alignment:
| Q |
173 |
tttgcaaaaacatacttggctaa-ttgattcatccacaaatccctttgtatttgatcctt |
231 |
Q |
| |
|
||||| |||| |||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
4818834 |
tttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctt |
4818893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 50 - 130
Target Start/End: Original strand, 4814643 - 4814722
Alignment:
| Q |
50 |
cttcaaaagcaacaactgccttacctgcccccaagaaaagtgcatcatctcaaccgcaacttaaatgtccgatggccggaa |
130 |
Q |
| |
|
|||| ||||||||| || ||||||||||||| |||||||| ||||||||||||||| ||| ||||||| |||||| |||| |
|
|
| T |
4814643 |
cttctaaagcaacacctaccttacctgcccc-aagaaaagggcatcatctcaaccgtcactgaaatgtcagatggctggaa |
4814722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 4865417 - 4865459
Alignment:
| Q |
1 |
aaaagaagctttgcagcctccaccagccatggct-tgccgcaa |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
4865417 |
aaaagaagctttgcagcctccaccagccacggctatgccgcaa |
4865459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University