View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20028_high_29 (Length: 264)
Name: NF20028_high_29
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20028_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 32482272 - 32482156
Alignment:
| Q |
18 |
taaacagtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagcagctatagcttccttcaacgtttgtttttgtgtaatact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482272 |
taaacagtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagcagctatagcttccttcaacgtttgtttttgtgtaatact |
32482173 |
T |
|
| Q |
118 |
cctaacttatgtttttt |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32482172 |
cctaacttatgtttttt |
32482156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 178 - 255
Target Start/End: Complemental strand, 32482111 - 32482034
Alignment:
| Q |
178 |
aggaaggaacagtaccacagtctttttacagctatctctgcactgcaaacgccgccatgcccctctctttctctctgc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482111 |
aggaaggaacagtaccacagtctttttacagctatctctgcactgcaaacgccgccatgcccctctctttctctctgc |
32482034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University