View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20028_high_9 (Length: 428)
Name: NF20028_high_9
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20028_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 18 - 409
Target Start/End: Original strand, 21791924 - 21792315
Alignment:
| Q |
18 |
aagaatggaagagcaccgaagtctagtaccaagccactcaagtagcaagaagacaaagaaggagaaaaggagagggattgatggcgacctcatattgcag |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21791924 |
aagaatggaaaagcaccgaagtctagtactaagccactcaagtagcaagaagacagagaaggagaaaaggagagggattgatggcgacctcatattgcgg |
21792023 |
T |
|
| Q |
118 |
taggtttggtcgtcgtcacaaatataaagaaacaatgaaaccctagaagagagggtgaatcacaaaatgccaaaatnnnnnnnnn-tgagttaggaattc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21792024 |
taggtttggtcgtcgtcacaaatataaagaaacaatgaaacc-tagaagagagggtgaatcacaaaatgccaaaataaaataaaaatgagttaggaattc |
21792122 |
T |
|
| Q |
217 |
gagtttcaatttcattcttcctgcttcnnnnnnncttcatctacacaactctaattattatagtttttgagacaataattatcgaattttggccggttcg |
316 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
21792123 |
gagtttcaatttcattcttcctgcttctttttttcttcatctacacaactctaattattatagtttttgagacaataattatcggattttagccggttcg |
21792222 |
T |
|
| Q |
317 |
gacttaaagcttcttaatttccaactctctattggtagatctttggagcttgttttctctatagagaatgttgcttcaattttccctctgtgg |
409 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
21792223 |
gacttacagcttcttaatttccaactctctgttggtagatctttggagcttgttttttctacagagaatgttgcttcaattttccctttgtgg |
21792315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University