View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20028_low_22 (Length: 340)
Name: NF20028_low_22
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20028_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 3298056 - 3297750
Alignment:
| Q |
19 |
ggattctttgcggtgtctttttccctgcattcacacattcaagtcataattggccgtctgattaaaagagcgagctcaaattaagactgcttgattttga |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
3298056 |
ggattccttgcggtgtctttttccctgcatttacacattcaattcataattggccgtctgattaaaagagcgagctcaaattaggactgcttgatcttga |
3297957 |
T |
 |
| Q |
119 |
tcgaagatcactgaaacatgactgcgtggttttgttgaacgcagtgaatcgtggtccgtattatcattgatcctcccataacatgctatcaagttattga |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || |||||| |||||||||||| ||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
3297956 |
tcgaagatcattgaaacatgactgcgtggttttgctggccgcagtaaatcgtggtccgcattattattgatcctcctatgacatgctatcaagttattga |
3297857 |
T |
 |
| Q |
219 |
tatcaaaacactcgggtcacaatcaagtacctactcaaaattcaaacaaagaacgatgttcaatgtttgtttgaagatgacaaattgcacaataacgttt |
318 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3297856 |
tatcattacactcgggtcacaatcaagtacctactcaaaattcaaacaaagaacgatgttcaatgtttgtttgaagatgacaaattgcacaataacgttt |
3297757 |
T |
 |
| Q |
319 |
ggagcat |
325 |
Q |
| |
|
||||||| |
|
|
| T |
3297756 |
ggagcat |
3297750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University