View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20028_low_25 (Length: 309)
Name: NF20028_low_25
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20028_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 298
Target Start/End: Complemental strand, 33642135 - 33641851
Alignment:
| Q |
17 |
gttgtccgatccggtcttgtgttacacaattgtatctgccctgactgcatnnnnnnnnnnntaataat---taaagattgatcataagatatgatatcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33642135 |
gttgtccgatccggtcttgtgttacacaattgtatctgccctgactgcataaaaaaaataataataataattaaagattgatcataagatatgatatcat |
33642036 |
T |
|
| Q |
114 |
tggaattatgtatgaagtttgacaatatatatacaatacatacctgaataccaaggtgctggcaccaattatttgaaggaaacatgatctctaggggagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33642035 |
tggaattatgtatgaagtttgacaatatatacacaatacatacctgaataccaaggtattggcaccaattatttgaaggaaacatggtctctaggggagg |
33641936 |
T |
|
| Q |
214 |
ctttgtatcaaaggtggatttccttttctctaaatttgtttgatccttgaagaattcttcggtaaatggttcctcaaactttctt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641935 |
ctttgtatcaaaggtggatttccttttctctaaatttgtttgatccttgaagaattcttcggtaaatggttcctcaaactttctt |
33641851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University