View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20028_low_32 (Length: 264)

Name: NF20028_low_32
Description: NF20028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20028_low_32
NF20028_low_32
[»] chr8 (2 HSPs)
chr8 (18-134)||(32482156-32482272)
chr8 (178-255)||(32482034-32482111)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 32482272 - 32482156
Alignment:
18 taaacagtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagcagctatagcttccttcaacgtttgtttttgtgtaatact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32482272 taaacagtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagcagctatagcttccttcaacgtttgtttttgtgtaatact 32482173  T
118 cctaacttatgtttttt 134  Q
    |||||||||||||||||    
32482172 cctaacttatgtttttt 32482156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 178 - 255
Target Start/End: Complemental strand, 32482111 - 32482034
Alignment:
178 aggaaggaacagtaccacagtctttttacagctatctctgcactgcaaacgccgccatgcccctctctttctctctgc 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32482111 aggaaggaacagtaccacagtctttttacagctatctctgcactgcaaacgccgccatgcccctctctttctctctgc 32482034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University