View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_20 (Length: 339)
Name: NF20029_low_20
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 139 - 327
Target Start/End: Original strand, 11173314 - 11173502
Alignment:
| Q |
139 |
tagaaattttcgtatactatcttttattaaatagaaatagcttaaacataagcatgttacctgaatttgatacgtctaagctcgttgttcccatcaggat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173314 |
tagaaattttcgtatactatcttttattatatagaaatagcttaaacataagcatgttacctgaatttgatacgtctaagctcgttgttcccatcaggat |
11173413 |
T |
 |
| Q |
239 |
actgcctgactgtgacaaatattccaggctcaacttgctcaatccattctgagtcagggtcactagagttgctgaaggaaatttcattc |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11173414 |
actgcctgactgtgacaaatattccaggctcaacttgctcaatccattctgagtcagggtcactagaattgctgaaggaaatttcattc |
11173502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 11173216 - 11173324
Alignment:
| Q |
1 |
ctcatcccaccatttccttgcctctgcatctccaaacctctgtcggctgcaaatacagttcaaaaaatcatcagcacagaccctacc-atcttctaaata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
11173216 |
ctcatcccaccatttccttgcctctgcatctccaaacctctgtcggctgcaaatacagttcaaaaaatcatcagtacagaccctaccaatcttctaaata |
11173315 |
T |
 |
| Q |
100 |
gaaattttc |
108 |
Q |
| |
|
||||||||| |
|
|
| T |
11173316 |
gaaattttc |
11173324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University