View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_24 (Length: 322)
Name: NF20029_low_24
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 176 - 283
Target Start/End: Complemental strand, 32918593 - 32918486
Alignment:
| Q |
176 |
cactccaccaataaagctaaattgatgtgttttggtatatttccaacttgaattgttaaaacacaaatcaatcaattcaaaatttcaaagtaacttcata |
275 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32918593 |
cactccaccaataaagctaaatttatctgttttggtatattttcaacttgaattcttaaaacacaaatcaatcaattcaaaatttcaaagtaacttcata |
32918494 |
T |
|
| Q |
276 |
cccataaa |
283 |
Q |
| |
|
|||||||| |
|
|
| T |
32918493 |
cccataaa |
32918486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 32918753 - 32918665
Alignment:
| Q |
16 |
atatatcaccaatttaatttaggataatctttaatatatggtaaactattttaaccggagaatcaatttattttttaggtgagatttta |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32918753 |
atatatcactaatttaatttaggataatctttaatatatggtaaactattttaataggagaatcaatttattttttaggtgagatttta |
32918665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University