View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_31 (Length: 297)
Name: NF20029_low_31
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 9 - 281
Target Start/End: Original strand, 21642352 - 21642624
Alignment:
| Q |
9 |
cgaaaatcaatgttttgttgaaccatttcaagagaaaaacactttgtgctcaacttgattcattgcttcaacaaaccctaccttttcatcaagtttgggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21642352 |
cgaaaatcaatgttttgttgaaccatttcaagagaaaaacactttgtgctcaacttgattcattgcttcaacaaaccctaccttttcatcaagtttgggt |
21642451 |
T |
 |
| Q |
109 |
gctttcgttcggaagtccaaacgaggcgtccctcaagagaatcgtggaaagctataacgattcgcggataagtttcataagctcgagttacgattttaag |
208 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21642452 |
gctttctttcggcagtccaaacgaggcgtccctcaagagaatcgtggaaagctataacgattcgcggataagtttcataagctcgagttatgattttaag |
21642551 |
T |
 |
| Q |
209 |
tactatggaaggtttcaaatggctttgcagacagaagctgatttggtttacattgttgatgatgatatgatac |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
21642552 |
tactatggaaggtttcaaatggctttgcagacagaagctgatttggtttatatcgttgatgatgatatgatac |
21642624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University