View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20029_low_37 (Length: 262)

Name: NF20029_low_37
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20029_low_37
NF20029_low_37
[»] chr4 (1 HSPs)
chr4 (1-247)||(32643680-32643926)


Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 32643680 - 32643926
Alignment:
1 atgaacctgccatcccaattgggggtggattgcccttgactacaaggctcgtgaaaaaggacatctctcttcagatgttcatcttgaaacggtacacggc 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||    
32643680 atgaacctgccatcccaattgggggtggattgcccttgaccacaaggctcgtgaaaaaggacatctctcttcagatgttcatcttgaaaaggcacacggc 32643779  T
101 aataaccggcataaaaaatgttctaaataacacatgcactcgaatttttaatgatgttttgcagatagttttgaaaagcaaaattatgattgcaacacga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32643780 aataaccggcataaaaaatgttctaaataacacatgcactcgaatttttaatgatgttttgcagatagttttgaaaagcaaaattatgattgcaacacga 32643879  T
201 ggtaccacatcacgaattcacacactcaatatgcctttggttcttcc 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
32643880 ggtaccacatcacgaattcacacactcaatatgcctttggttcttcc 32643926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University