View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_41 (Length: 252)
Name: NF20029_low_41
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 34227447 - 34227320
Alignment:
| Q |
20 |
catagaagcttgacagaagcagataccttataccaacaactttcttgatatcat----cttcaagtgcacagttcatgtacttaaagaagatattttgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34227447 |
catagaagcttgacagaagcagataccttataccaacaactttcttgatatcattcatcttcaagtgcacagttcatgtacttaaagaagatattcggct |
34227348 |
T |
|
| Q |
116 |
cgctaacattgaaccagtggtcaagcaa |
143 |
Q |
| |
|
| |||||||||||||||| ||||||||| |
|
|
| T |
34227347 |
cactaacattgaaccagtagtcaagcaa |
34227320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 144 - 222
Target Start/End: Complemental strand, 34227292 - 34227209
Alignment:
| Q |
144 |
aaactagtgtcattgtctgcatagctgatgtgaaaaata-----ctaatccggataccagaaactaattacgtcgcagaatttc |
222 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| | |||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
34227292 |
aaactagtgtcgttgtctgcatagttgatgtgaaaaaaaaaaaactaatccggataccagaaactaattatgtctcagaatttc |
34227209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 98
Target Start/End: Original strand, 2755394 - 2755471
Alignment:
| Q |
21 |
atagaagcttgacagaagcagataccttataccaacaactttcttgatatcatcttcaagtgcacagttcatgtactt |
98 |
Q |
| |
|
|||||| ||||| |||||| |||||| ||||| ||||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
2755394 |
atagaaacttgatagaagcgcatacctaataccgacaactttcttgaaatcatcttcaagcgcacggttcatgtactt |
2755471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University