View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_44 (Length: 247)
Name: NF20029_low_44
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 43452990 - 43453213
Alignment:
| Q |
1 |
taggagggtaacaccaaaaagtgcaggtcttcgagcagaatcggttttgttgacaaacaatggtccttttagggaattttataagttaggagatgaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452990 |
taggagggtaacaccaaaaagtgcaggtcttcgagcagaatcggttttgttgacaaacaatggtccttttagggaattttataagttaggagatgaactt |
43453089 |
T |
 |
| Q |
101 |
gggaaaggaaagtttggaactacttcactttgtttggagaaatcaaccgggaagacatacgcatgcaaagcaataccaaaggtaaaattgtttagagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453090 |
gggaaaggaaagtttggaactacttcactttgtttggagaaatcaaccaggaagacatacgcatgcaaagcaataccaaaggtaaaattgtttagagaga |
43453189 |
T |
 |
| Q |
201 |
atgatatagaggatgtgaggaggg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43453190 |
atgatatagaggatgtgaggaggg |
43453213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 43462433 - 43462652
Alignment:
| Q |
5 |
agggtaacaccaaaaagtgcaggtcttcgagcagaatcggttttgttgacaaacaatggtccttttagggaattttataagttaggagatgaacttggga |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |||||||| ||||||||||| |||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
43462433 |
agggtaacagcaaaaagtgcaggtcttcgagaagaatcaattttgttgtcaaacaatggttcttttaaggaatactatgagttaggagatgaacttggag |
43462532 |
T |
 |
| Q |
105 |
aaggaaagtttggaactacttcactttgtttggagaaatcaaccgggaagacatacgcatgcaaagcaataccaaaggtaaaattgtttagagagaatga |
204 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||| || || |||||||| | ||| |||||||| |||||||| ||| |||| |
|
|
| T |
43462533 |
aaggggaatttggaactacttcactttgtttggagaaatcaaccgggaaaacgtatgcatgcaaggtaatcccaaaggtgaaattgttagaagatgatga |
43462632 |
T |
 |
| Q |
205 |
tatagaggatgtgaggaggg |
224 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
43462633 |
tgtagaggatgtgaggaggg |
43462652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University