View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_52 (Length: 236)
Name: NF20029_low_52
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 28237198 - 28237419
Alignment:
| Q |
1 |
ttttatgtcaaaatattatttctatataaccaaatagaaagaagaagaagaggtgtcttgtgagtagtgtctaacaagtgttgagcgcatggcagcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28237198 |
ttttatgtcaaaatattatttctatataactaaatagaaagaagaagaagaggtggcttgtgagtagtgtctaacaagtgttgagcgcatggcagcttgt |
28237297 |
T |
|
| Q |
101 |
ggttggccttgcttgcgggacaccaaacacacgagaacttgaggtaagcattgccttaacgccacaactaccacaatcttagttaatatccacaattatt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28237298 |
ggttggccttgcttgcgggacaacaaacacacgagaacttgaggtaagcattgccttaacgccacaactaccacaatcttagttaatatccacaattatt |
28237397 |
T |
|
| Q |
201 |
gtggtccattcccttcattatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28237398 |
gtggtccattcccttcattatt |
28237419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University