View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_53 (Length: 227)
Name: NF20029_low_53
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 44298743 - 44298532
Alignment:
| Q |
1 |
gtgcttcagagaaccattgcaccataaggcctctcattgctgcactttgcttccatcaactctttgaaggaatgggtttgggtggttgcatacttcaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298743 |
gtgcttcagagaaccattgcaccataaggcctctcattgctgcactttgcttccatcaactctttgaaggaatgggtttgggtggttgcatacttcaggt |
44298644 |
T |
|
| Q |
101 |
aatgattattaattccatttaatttcattgaagaatttacaatatgagcaaattattccattaatgtgacaggctgattatggaacgaagatgaaatcga |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298643 |
aatgatt----attccatttaatttcattgaagaatttacaatatgagcaaattattccattaatgtgacaggctgattatggaacgaagatgaaatcga |
44298548 |
T |
|
| Q |
201 |
caatgatattcttctt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44298547 |
caatgatattcttctt |
44298532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University