View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_55 (Length: 225)
Name: NF20029_low_55
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 33 - 203
Target Start/End: Complemental strand, 3587171 - 3587001
Alignment:
| Q |
33 |
taatccagagtaaaaatccatatactcgtgcacaattcagcgagctcacgtacgaacttaattnnnnnnntgtatttaaactcttggcaaccgaatacag |
132 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
3587171 |
taatccagagtaaaaatccacatacccgtgcacaattcagcgagctcacgtacgaacttaattaaaaaaatgtatttaaacttttagcaaccgaatacag |
3587072 |
T |
|
| Q |
133 |
gttctttataaggctaaggataagactgctaacacgaattaattgaaccttatacctataacccaccgcac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3587071 |
gttctttataaggctaaggataagactgctaacacgaattaattgaaccttatacctataacccaccgcac |
3587001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University