View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20029_low_57 (Length: 203)
Name: NF20029_low_57
Description: NF20029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20029_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 10 - 182
Target Start/End: Original strand, 48606404 - 48606573
Alignment:
| Q |
10 |
agaagcaaaggacaataagaaaagggaannnnnnngaatatagtgcagtggtgtgaggaagagtcacaatccgagttttcaatcttctttttgtgtgtga |
109 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48606404 |
agaagtaaaggacaataagaaaagggaatttttttgaatatagtgcagtggtgtgaggaagagtcacaatcagagttttcaatcttctttttgtgtgtga |
48606503 |
T |
|
| Q |
110 |
ttccatttcggtaataaataaattnnnnnnnnnnncagtgcttttttgtgaattggaatagcatgtgacttgt |
182 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48606504 |
ttccatttcggtaataaataaat---aaataaaaacagtgcttttttgtgaattggaatagcatgtgatttgt |
48606573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University