View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20030_low_5 (Length: 289)
Name: NF20030_low_5
Description: NF20030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20030_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 9412240 - 9412513
Alignment:
| Q |
1 |
agtagcagaagtttctgtcagtttcattttaattattagcagcataacatagca------ttcaaaagaggcatatcagcaaggcttcaaaaacaacttc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| || |||||||||||| |||||||| ||||||||||| ||| |
|
|
| T |
9412240 |
agtagcagaagtttctgtcagtttcatttcaattattagtagcataacatagcaacaacatttaaaagaggcatagcagcaaggtttcaaaaacaagttc |
9412339 |
T |
|
| Q |
95 |
gacaccgcaatatggctgcatcatcattgcnnnnnnnnnnnnnncacaacagcaattgaagttgcatcaatcacattcactgtgattctctgcaatatca |
194 |
Q |
| |
|
||||||||||| | |||||| ||||||||| ||||||| ||||||||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
9412340 |
gacaccgcaatcttgctgcagcatcattgcttttttatatttt-cacaacaacaattgaagttgcatcagtcacatttactatgattctctgcaatatca |
9412438 |
T |
|
| Q |
195 |
atgattgcaacagtttccacagccacaattcaaaaccttgtatattagtagtttaaagtttaagaaactactcat |
269 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
9412439 |
atgattgcaatagtatccacagccacaattcaaaaccttggatattagtagtttatagtttaagaaactactcat |
9412513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University