View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20030_low_9 (Length: 237)
Name: NF20030_low_9
Description: NF20030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20030_low_9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 30179906 - 30179673
Alignment:
| Q |
4 |
gaagcttaccatggaaatccagtgagatcatgaaaggattcgagcaatgaaatgacggcacgaactggaaaaacagggatatcttcgctgccggcactat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30179906 |
gaagcttaccatggaaatccagtgagatcatgaaaggattcgagcaatgaaatgacggcacgaactggaaaaacagggatatcttcgctgccggcactat |
30179807 |
T |
|
| Q |
104 |
cagcgattgttttcagaatctcggagtgaaccggcgagtcgagacctaacgagtcggtatccagttcgtcattggaagaaccagtggagaaagcgcgtgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30179806 |
cagcgattgttttcagaatctcggagtgaaccggcgagtcgagacctaacgagtcagtatccagttcgtcattggaagaaccagtggagaaagcgcgtgt |
30179707 |
T |
|
| Q |
204 |
gtggaacgcgtcgagaaaggttggagttggagaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30179706 |
gtggaacgcgtcgagaaaggttggagttggagaa |
30179673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University