View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20031_high_11 (Length: 326)
Name: NF20031_high_11
Description: NF20031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20031_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 43533068 - 43533284
Alignment:
| Q |
1 |
tttgaaaaatgtggtgaaattttgaaacatgttcctggccctagagatgctaactggatgcacattttgtatcaggtttgcaatcttcctcttgcttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533068 |
tttgaaaaatgtggtgaaattttgaaacatgttcctggccctagagatgctaactggatgcacattttgtatcaggtttgcaatcttcctcttgcttgaa |
43533167 |
T |
 |
| Q |
101 |
tactatgattaaatttttctttataaagcaatggccgtatcttgtgtgccaatccaagaccatccatccagctattatgacattgttgtcatagtccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43533168 |
tactatgattaaatttttctttataaagcaatggccgtttcttgtgtgccaatccaagaccatccatccagctattttgacattgttgtcatagtccttt |
43533267 |
T |
 |
| Q |
201 |
tatcaatattcccaatg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43533268 |
tatcaatattcccaatg |
43533284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 276 - 313
Target Start/End: Original strand, 43533343 - 43533380
Alignment:
| Q |
276 |
agttgctgtttgttaaccaccctgatattagcctatgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533343 |
agttgctgtttgttaaccaccctgatattagcctatgc |
43533380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University