View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20031_high_13 (Length: 276)
Name: NF20031_high_13
Description: NF20031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20031_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 262
Target Start/End: Complemental strand, 43601860 - 43601608
Alignment:
| Q |
10 |
ataattctcagttccctttcagttgtactcagtctagcatatgcccagatttatatcagcatttgccaattgccattgcaacttcgcacaaagcatcatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43601860 |
ataattctcagttccctttcagttgtactcagtctagcatatgcccagatttatagcagcatttgccaattgccaatgcaacttcgcacaaagcatcatt |
43601761 |
T |
|
| Q |
110 |
aaaattataataaccacaggtttcaggttgtgatgtgaaatttttatttcattcaattctctaatgatacaagggaggcatatatatggccaatctcaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601760 |
aaaattataataaccacaggtttcaggttgtgatttgaaatttttatttcattcaattctctaatgatacaagggaggcatatatatggccaatctcaaa |
43601661 |
T |
|
| Q |
210 |
tgctaaacataaaagtatacaatacttgcattgcaagtaatcccttaaaactg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601660 |
tgctaaacataaaagtatacaatacttgcattgcaagtaatcccttaaaactg |
43601608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 8440748 - 8440677
Alignment:
| Q |
137 |
ttgtgatgtgaaatttttatttcattcaattctctaatgatacaagggaggcatatatatggccaatctcaaa |
209 |
Q |
| |
|
|||| ||||||||| || ||||||||| || ||||||||||||||||||||| ||| ||| |||||| ||||| |
|
|
| T |
8440748 |
ttgtaatgtgaaatattgatttcattccat-ctctaatgatacaagggaggcttatttatagccaatttcaaa |
8440677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 1176062 - 1175999
Alignment:
| Q |
145 |
tgaaatttttatttcattcaattctctaatgatacaagggaggcatatatatggccaatctcaaa |
209 |
Q |
| |
|
|||||| || |||||||||| ||| ||||||||||||||||||| ||| ||| |||||||||||| |
|
|
| T |
1176062 |
tgaaatattgatttcattca-ttcgctaatgatacaagggaggcttatttatagccaatctcaaa |
1175999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 261
Target Start/End: Complemental strand, 29259294 - 29259233
Alignment:
| Q |
200 |
caatctcaaatgctaaacataaaagtatacaatacttgcattgcaagtaatcccttaaaact |
261 |
Q |
| |
|
||||||||||||||||| ||||| ||| | |||||||||| |||||||| |||||||||| |
|
|
| T |
29259294 |
caatctcaaatgctaaatccaaaagaatagattacttgcattacaagtaattccttaaaact |
29259233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University