View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20031_high_16 (Length: 220)
Name: NF20031_high_16
Description: NF20031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20031_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 14 - 164
Target Start/End: Complemental strand, 9939310 - 9939163
Alignment:
| Q |
14 |
cataggcaatgatgtttaaatatccaattttgttagctgcatgtatcatgatgtttaaatatccaactatggacgccaccatctccgcgtcaaaacaaga |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9939310 |
catagacaatgatgtttaaatatccaattttgttagctgcatgtatcatg---tttaaatatccaaccatggacgccaccatctccgcgtcaaaacaaga |
9939214 |
T |
 |
| Q |
114 |
ccggaagtcgaccaacaccagcgctcctctctactccggcaacgaaaccca |
164 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
9939213 |
ccggaattcgaccaacaccagcgctcctctctactccagcaacggaaccca |
9939163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 162 - 205
Target Start/End: Complemental strand, 9939147 - 9939104
Alignment:
| Q |
162 |
ccaaagcagaactcactgaacgtcgtgaaaaggggctttgtttt |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9939147 |
ccaaagcggaactcactgaacgtcgtgaaaaggggctttgtttt |
9939104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University