View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20031_high_18 (Length: 203)

Name: NF20031_high_18
Description: NF20031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20031_high_18
NF20031_high_18
[»] chr4 (1 HSPs)
chr4 (19-187)||(51727571-51727739)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 51727739 - 51727571
Alignment:
19 atgcagcattcgcaaatgaattgaaaatatacaaacagtaatgtagcttgaggtgcaagttcnnnnnnnatacaaatcttgggtcaagttcnnnnnnnat 118  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||| |||||||||       ||    
51727739 atgcagcatttgcaaatgaattgaaaatatacaaacagtaatgtagcttgaggtgcaagttctttttttatacaaatcttgagtcaagttctttttttat 51727640  T
119 tttgcttcattcttagatagttactggttatgattgttgcttgatactgaatttgttatggtttggaag 187  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
51727639 tttgcttcattcttagatagttactggttatgattattgcttgatactgaatttgttatggtttggaag 51727571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University