View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20031_high_5 (Length: 556)
Name: NF20031_high_5
Description: NF20031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20031_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 4e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 389 - 546
Target Start/End: Original strand, 28850169 - 28850326
Alignment:
| Q |
389 |
atggaaagcaaaacatctttcctttgctggtagagtgacttttgctaaatcatttattgaagcagttcctatttatccgatgatgagttgtgttattcct |
488 |
Q |
| |
|
||||| |||||||||||||||||||| ||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28850169 |
atggatagcaaaacatctttcctttgtcggttgagtgactcttgctaaatcagttattgaagcagtttttatttatccgatgatgagttgtgttattcct |
28850268 |
T |
|
| Q |
489 |
aaatcgtatcttcatgagattcagaagttgcaaagaggttttatttggggtgatgatg |
546 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
28850269 |
aaatcgtgtctttatgagattcagaagttgcaaagagattttatttggggtgaggatg |
28850326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 348 - 437
Target Start/End: Complemental strand, 21311199 - 21311110
Alignment:
| Q |
348 |
tttcagtatattattgatcaagtgagaaataaactggtgtcatggaaagcaaaacatctttcctttgctggtagagtgacttttgctaaa |
437 |
Q |
| |
|
|||||||||||| |||||||||| || ||||| || || | |||||||| ||||| ||||||||| | || ||||| ||||| |||||| |
|
|
| T |
21311199 |
tttcagtatattgttgatcaagtcagcaataagcttatggcctggaaagctaaacaactttcctttccagggagagttactttggctaaa |
21311110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University