View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20031_low_18 (Length: 203)
Name: NF20031_low_18
Description: NF20031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20031_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 51727739 - 51727571
Alignment:
| Q |
19 |
atgcagcattcgcaaatgaattgaaaatatacaaacagtaatgtagcttgaggtgcaagttcnnnnnnnatacaaatcttgggtcaagttcnnnnnnnat |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| || |
|
|
| T |
51727739 |
atgcagcatttgcaaatgaattgaaaatatacaaacagtaatgtagcttgaggtgcaagttctttttttatacaaatcttgagtcaagttctttttttat |
51727640 |
T |
|
| Q |
119 |
tttgcttcattcttagatagttactggttatgattgttgcttgatactgaatttgttatggtttggaag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51727639 |
tttgcttcattcttagatagttactggttatgattattgcttgatactgaatttgttatggtttggaag |
51727571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University