View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20032_low_6 (Length: 233)
Name: NF20032_low_6
Description: NF20032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20032_low_6 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 41 - 226
Target Start/End: Complemental strand, 40010 - 39825
Alignment:
| Q |
41 |
aattttttgagactgatctgtatgcttttaatatccaacaacatgatctctctgcttctttagatgaccttttcgatgttgtcatacaaaacatcttctt |
140 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40010 |
aattttttgagactgctctgtatgcttttaatatccaacaccatgatctttctacttctttagatgaccttttcgatgttgtcctacaaaacatcttctt |
39911 |
T |
 |
| Q |
141 |
ttagcactgcctcaattcatttatcactaaatcagtagctgctctctaatgccaagtctgatcaacttcccactacctttgctact |
226 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
39910 |
ttggcactgcctcaattcatttatcactaaatcagtaactgctctctaatgcccagtctgatcaacttcccactacttttggtact |
39825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University