View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20033_high_11 (Length: 215)
Name: NF20033_high_11
Description: NF20033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20033_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 23 - 199
Target Start/End: Original strand, 14944148 - 14944324
Alignment:
| Q |
23 |
ttgatgctggttgaagcaaccatgaatcttgcaaaaccttggttcggttataccactttgttggaggtaactgttacatttagctatctcacatacactt |
122 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14944148 |
ttgatgctagttgaagcaaccatgaatcttgcaaaaccttggttctgttataccactttgttggagataactgttacatttagctatctcacatacactt |
14944247 |
T |
 |
| Q |
123 |
tgtgaagattctttagggagagttaattgatgagagatcaattattttttattatgacttattatgcaagtaacact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14944248 |
tgtgaagattctttagggagagttaattgatgagagatcaattattttttattatgacttattatgcaagtaacact |
14944324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University