View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20033_low_12 (Length: 248)
Name: NF20033_low_12
Description: NF20033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20033_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 53 - 230
Target Start/End: Complemental strand, 42748272 - 42748095
Alignment:
| Q |
53 |
ggcttagtccttagttacttgcaatagaaaggtaccagcccactagttataaaattcacatgttatgtcatcaatgctacggtatttgaggcttgtgaga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42748272 |
ggcttagtccttagttacttgcaatagaaaggtaccagcccactagttataaaattcacatgttatgtcatcaatgctacggtatttgaggcttgtgaga |
42748173 |
T |
 |
| Q |
153 |
gtgattttcaagttaaaccaaagttgtcacttgcttaaaatacttgccatgagtacttttaatatccatttccctatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42748172 |
gtgattttcaagttaaaccaaagttgtcacttgcttaaaatacttgctatgagtacttttaatatccatttccctatg |
42748095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University