View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20035_high_10 (Length: 216)
Name: NF20035_high_10
Description: NF20035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20035_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 50076105 - 50076288
Alignment:
| Q |
20 |
taatacaaagtgtaacgaaggttgagtttatcataagtggttagactgtctaccataacacagcgaatcaaaatttaagtccaagttaaaaatagaataa |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50076105 |
taatacaaaggctaacgaaggttgagtttatcataagtggttagactgcctaccataacacagcgaatcaaaatttaagtccaagttaaaaatagaataa |
50076204 |
T |
|
| Q |
120 |
tgaatacgagagaaaattccccccaaagaattaacact----ttaatcctcaataacaaaggagaacaagcagccacccacact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50076205 |
tgaatacgagagaaaattccccccaaagaattaaaactttaattaatcctcaataacaaaggagaacaaacagccacccacact |
50076288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University