View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20035_high_7 (Length: 270)
Name: NF20035_high_7
Description: NF20035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20035_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 144 - 252
Target Start/End: Complemental strand, 9595893 - 9595789
Alignment:
| Q |
144 |
cttcaaagtgttagggtgcacatgaattgagttcacgtacgtatacctactcaaaatgagtttatggagactgacgtgaacttcattcatgtatcttcaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9595893 |
cttcaaagtgttagggtgcacatgaattgagttcacgta----tacctactcaaaatgagttcatggagactgacgtgaacttcattcatgtatcttcaa |
9595798 |
T |
 |
| Q |
244 |
ttttcatat |
252 |
Q |
| |
|
||||||||| |
|
|
| T |
9595797 |
ttttcatat |
9595789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University