View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20035_low_3 (Length: 476)
Name: NF20035_low_3
Description: NF20035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20035_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 16 - 333
Target Start/End: Complemental strand, 20359390 - 20359073
Alignment:
| Q |
16 |
ataatagagttttcgaatgattgtgaccaagcatgttttgttacttgttctctcattattcaaatttacattagtgaaactaacatccttcattcgagat |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20359390 |
ataatagagttttcggatgattgtgaccaagcatgttttgttacttgttctctcattattcaaatttacattagcgaaactaacatccttcattcgagat |
20359291 |
T |
|
| Q |
116 |
taattgagagcaatctccacctttacttcccaaacatatcttgattcacaagtcttaggtctctgatcgctaagcaccctcttgatttaggcttattcac |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20359290 |
taattgatagcaatctccacctttacttcccaaacatatcttgattcacaagtcttaggtctctgatcgctaagcatcctcttgatttaggcttattcac |
20359191 |
T |
|
| Q |
216 |
atttgacgaacaaatcgaaggtatcttctagacccccttcgaccctccccaaaggaagcgatcggagacccataaccctcttccaaaccttcattggcaa |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20359190 |
atttgacgaacaaatcgaaggtatcttctagacccccttcgaccctccccaaaggaagcgatcggagacccataatcctcttccagaccttcattggcaa |
20359091 |
T |
|
| Q |
316 |
cttcacaaaataaaggta |
333 |
Q |
| |
|
||||| |||| ||||||| |
|
|
| T |
20359090 |
cttcataaaagaaaggta |
20359073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 361 - 420
Target Start/End: Complemental strand, 20359072 - 20359013
Alignment:
| Q |
361 |
taataaaaaatgaccctcgagtttatagtcagcccaaaacaatgttggttagacatagac |
420 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
20359072 |
taataaaaaatgaccctcgagtttaaagtcagcccaaaacaatgctggttagacatagac |
20359013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 52 - 108
Target Start/End: Complemental strand, 20358694 - 20358638
Alignment:
| Q |
52 |
tttgttacttgttctctcattattcaaatttacattagtgaaactaacatccttcat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
20358694 |
tttgtcacttgttctctcattattcaaatttacattaacaaaacaaacatccttcat |
20358638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University