View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20036_low_11 (Length: 267)
Name: NF20036_low_11
Description: NF20036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20036_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 22 - 256
Target Start/End: Original strand, 43094942 - 43095176
Alignment:
| Q |
22 |
ttttatgcaatgtgaaactcgaacaataaatttaaattttgaaatcaaatttgcagactagattgcaatttctaacttctaacttagaattaattttaac |
121 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43094942 |
ttttatgtaatgtgaaacttgaacaataaatttaaatgttgaaatcaaatttgcagactaaattgaaatttctaacttctaacttagaattaattttaac |
43095041 |
T |
|
| Q |
122 |
tcttcaaaatcacttttgactctactaaaattgaatccaaatacctactatttaacaatataatccttagtctttacacacaacaaagaggcaataaaga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43095042 |
tcttcaaaatcacttttgactctactaaaattgaatccaaatatctactatttaacaatataatccttagtctttacgcacaataaagaggcaataaaga |
43095141 |
T |
|
| Q |
222 |
aatcatctagctctcaagatatatatcacaggttc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43095142 |
aatcatctagctctcaagatatatatcacaggttc |
43095176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 113 - 160
Target Start/End: Complemental strand, 35728892 - 35728845
Alignment:
| Q |
113 |
aattttaactcttcaaaatcacttttgactctactaaaattgaatcca |
160 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
35728892 |
aattttaattcttcaaaatcacttttgactcttccaaaagtgaatcca |
35728845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University