View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20036_low_14 (Length: 237)

Name: NF20036_low_14
Description: NF20036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20036_low_14
NF20036_low_14
[»] chr3 (1 HSPs)
chr3 (1-221)||(51736301-51736521)
[»] chr1 (1 HSPs)
chr1 (11-221)||(358829-359039)
[»] chr4 (1 HSPs)
chr4 (24-61)||(37847500-37847537)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 51736521 - 51736301
Alignment:
1 ctgctatgtgctatcgaaatagatctgggaaagaccacattatgaacattgcaaaaatgtctgagtcaagaaattcaatatgtgcagcccgcccaatgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51736521 ctgctatgtgctatcgaaatagatctgggaaagaccacattatgaacattgcaaaaatgtctgagtcaagaaattcaatatgtgcagcccgcccaatgaa 51736422  T
101 agagttcaaattcttgccatgggcagaggcatcaaaatttacatcacatcgcatgaatactcgatgttcagaggggttggcacgtatttggtccaaacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51736421 agagttcaaattcttgccatgggcagaggcatcaaaatttacatcacatcgcatgaatactcgatgttcagaggggttggcacgtatttggtccaaacaa 51736322  T
201 gcattcagcatctctaggaac 221  Q
    |||||||||||||||||||||    
51736321 gcattcagcatctctaggaac 51736301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 359039 - 358829
Alignment:
11 ctatcgaaatagatctgggaaagaccacattatgaacattgcaaaaatgtctgagtcaagaaattcaatatgtgcagcccgcccaatgaaagagttcaaa 110  Q
    |||||||||||| ||||| || ||||||||||||||| ||||||||||||| || || ||||| |||||||| ||||||||||| ||||||||||| |||    
359039 ctatcgaaatagttctggaaatgaccacattatgaaccttgcaaaaatgtcagactccagaaactcaatatgagcagcccgcccgatgaaagagtttaaa 358940  T
111 ttcttgccatgggcagaggcatcaaaatttacatcacatcgcatgaatactcgatgttcagaggggttggcacgtatttggtccaaacaagcattcagca 210  Q
    ||||| |||| |||||  ||||||||||| |||||||| ||||| ||||||||| |||||||||| |||||||| ||||||||||||||| |||| ||||    
358939 ttctttccataggcagtagcatcaaaattgacatcacaacgcataaatactcgacgttcagagggattggcacggatttggtccaaacaatcattaagca 358840  T
211 tctctaggaac 221  Q
    |||||||||||    
358839 tctctaggaac 358829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 61
Target Start/End: Original strand, 37847500 - 37847537
Alignment:
24 tctgggaaagaccacattatgaacattgcaaaaatgtc 61  Q
    |||||||||||||||||||||||| |||| ||||||||    
37847500 tctgggaaagaccacattatgaactttgcgaaaatgtc 37847537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University