View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20036_low_8 (Length: 354)
Name: NF20036_low_8
Description: NF20036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20036_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 22016571 - 22016398
Alignment:
| Q |
17 |
aatccaaagttagaagtgtagcaaagtggctatgttacactccttgattaataaacacaaatgtgcagaatggcaaaattattatagcactattaaagcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016571 |
aatccaaagttagaagtgtagcaaagtggctatgttacactccttgattaataaacacaaatgtgcagaatggcaaaattattatagcactattaaagcc |
22016472 |
T |
 |
| Q |
117 |
attaagggagactattaaagccatatttctagaggatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc |
212 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016471 |
a----------------------tatttctagatgatgtgaaactaaagtcaaaacacactcttcacaccagcacaacaaagatactagaggaagc |
22016398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 210 - 339
Target Start/End: Complemental strand, 22016363 - 22016230
Alignment:
| Q |
210 |
agctagaggtggattgaaactcaggcagctttt-ccaacacggtatgtatatgctaggagggaaaacaactgaacaacaacaaaaccttttcttactagt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22016363 |
agctagaggtggattgaaactcaggcagctttttccaacacagtacgtacatgctaggagggaaaacaactgaacaacaacaaaaccttttctcactagt |
22016264 |
T |
 |
| Q |
309 |
gggcttaactaca---atcaaaacctgtcataaa |
339 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |
|
|
| T |
22016263 |
cggcttaactacagccatcaaaacctgtcttaaa |
22016230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University