View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20037_high_12 (Length: 372)
Name: NF20037_high_12
Description: NF20037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20037_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 17 - 357
Target Start/End: Original strand, 455568 - 455917
Alignment:
| Q |
17 |
gaccacaaccttggaaagtgatgagaattggttgattggttgtctctttctgttgggaagtagtgttgccggctcaatttggctaattttgcaggtattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
455568 |
gaccacaaccttggaaagtgatgagaattggttgattggttgtctctttctgttgggaagtagtgttgccggctcaatttggctaattttgcaggtattt |
455667 |
T |
|
| Q |
117 |
gattgtgacaatataagtatcacttttagtgggtgaggttgaggttgagggcctacgtacgatgaaaccatgtgc---------tttattggttaaaaac |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
455668 |
gattgtaacaatataagtatcacttttagtgggtgaggttgaggttgaggacctacgtacgatgaaaccatgtgctttatttgatttattggttaaaaac |
455767 |
T |
|
| Q |
208 |
caacttcaccatggtaaaaaactttagggttatgcatctcttagagcactagttaagaagataaaactcgtcttggtctctcttgtcatgcatatataat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
455768 |
caacttcaccatggtaaaaaactttagggttatgcgtctcgtagagcactagttaagaagataaaactcgtcttggtctctcttatcatgcatatataat |
455867 |
T |
|
| Q |
308 |
atattgcccccgtacattcatttacattgggatcgttggctatcatttgt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
455868 |
atattgcccccgtacattcatttacattgggatcgttggctatcatttgt |
455917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 474896 - 474979
Alignment:
| Q |
33 |
agtgatgagaattggttgattggttgtctctttctgttgggaagtagtgttgccggctcaatttggctaattttgcaggtattt |
116 |
Q |
| |
|
|||||||| | ||||||| |||| ||| | | ||| |||||||||||||||||| | ||| ||||||| ||||||||||||||| |
|
|
| T |
474896 |
agtgatgatagttggttgcttggatgtgtgtatcttttgggaagtagtgttgcctggtcactttggctcattttgcaggtattt |
474979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 27491494 - 27491398
Alignment:
| Q |
20 |
cacaaccttggaaagtgatgagaattggttgattggttgtctctttctgttgggaagtagtgttgccggctcaatttggctaattttgcaggtattt |
116 |
Q |
| |
|
||||||||| | ||||||||||||||||||| |||| ||| | |||| || ||||| |||||||| | ||| ||||||| ||||||||||||||| |
|
|
| T |
27491494 |
cacaaccttaggaagtgatgagaattggttgcttggatgtttggttctttttggaagctgtgttgcctggtcagtttggcttattttgcaggtattt |
27491398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University