View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20037_high_32 (Length: 206)
Name: NF20037_high_32
Description: NF20037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20037_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 9 - 182
Target Start/End: Complemental strand, 33744618 - 33744445
Alignment:
| Q |
9 |
ggtagataatacttgccgtacaataaattgatgttttatttacagtaaaataaatttcattcaaattctatatttgtgagagtacaatcaaattgattaa |
108 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33744618 |
ggtaaataatatttgccgtacaataaattgatgttttatttacagtaaaataaatttcattcaaatactatatttgtgagagtacaatcaaattgattaa |
33744519 |
T |
|
| Q |
109 |
taacattttccattcacatcctaaaaatcaaaaacattatatcaacacttcaaaatttcagaaagataaaagta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33744518 |
taacattttccattcacatcctaaaaatcaaatacattatatcaacacttaaaaatttcagaaagataaaagta |
33744445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University